Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SaveTab

-

Save formatted table


CommandArgument DatatypeDefaultMinMax
Format:SaveTabTable selection, SELECTION---
  Filename = Table filename,STRING - --
  Format = Text, STRING---
  Columns = Table columns in the output file,INT- - -
   NumFormat = Number format,STRING - --
  Header = Table header line STRING---
Python:SaveTab(selection1,filename,format,columns,numformat,header)
Menu:Options > Table > Save
Related: Tab , Tabulate, DelTab , SelectTab, MakeTab , LoadTab, ShowTab , FlipTab
Required:


The SaveTab command saves a table that has been created before by tabulating various kinds of data in plain text format for easy import into other programs.

If you did not create additional tables, just input '1' or 'Default' as your table selection to save the default table containing the cells added with the Tabulate command.

Several different table formats will be supported in the future, currently the only one available is plain text. In this case, the Columns parameter specifies the number of columns per table row, and NumFormat defines the format used to print the numbers.

Examples of typical number formats:
10.4fPrint numbers right-justified with four digits behind the decimal point and pad them to 10 character
6.0f Round numbers to integers and pad them to 6 characters
-6.0fAs above, but print left-justified
8.2e Print numbers in exponential form with two digits behind the decimal point

Any text strings contained in the table will be padded with spaces to match the width of the number format, e.g. a NumFormat of -10.2f will ensure that all strings occupy at least 10 characters and are printed left-justified.

An example of the text format is given by the LoadTab command.

If the Columns parameter is left out, it will be the one chosen upon creation of the table .

Example:
SaveTab 1,MyTable,Format=Text,Columns=3,NumFormat=6.2f,RMSD1  RMSD2  RMSD3

Save all cells in table 1 as a formatted text table dat/MyTable.tab starting with the header line "RMSD1 RMSD2 RMSD3" and then three numbers per line using a 6.2f floating point format.