Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SaveSim

-

Save simulation snapshots in sim format


CommandArgumentDatatypeDefault Min Max
Format 1:SaveSim Filename = Snapshot filename with terminal numbers,STRING---
  Steps = Number of simulation cycles between snapshots INT ---
Format 2: SaveSimOff STRING---
Python:SaveSim(filename,steps)
SaveSimOff()
Menu:File > Save as > Simulation snapshot
Related:LoadSim, SaveXTC , LoadXTC, Sim
Required:


The SaveSim command periodically saves a snapshot of a running simulation (consisting of atom positions and velocities). These snapshots can be used to analyze a simulation, to play it back quickly, or continue at a certain point after power failures etc.

The specified filename must contain zeroes at the end, which will be replaced with the sequential snapshot number. The snapshot number is obtained by dividing the current simulation cycle by the Steps parameter. If you thus change the Steps parameter during a simulation, the snapshot number will change accordingly, leading to either a gap (smaller 'Steps') or overwriting existing snapshots (larger 'Steps').

If you accidentally specified a filename with too few digits so that there is not enough space to store the steadily increasing snapshot number, YASARA will raise an error during the simulation. You then need to rename the existing snapshot filenames (e.g. 1crn0.sim should be renamed to 1crn00000.sim etc.), adapt any private macros to work with the larger numbers, issue a new SaveSim command and continue the simulation by loading the last snapshot as shown in the md_run example macro.

To save disk space, the snapshots are saved in binary format and single precision. If you feel that snapshots take too much space, either increase the save interval specified by the Steps parameter or use the compressed XTC format . Since the XTC format does not store atom velocities, another option is to use both SaveSim and SaveXTC commands together, with a larger save interval for SaveSim .

An example for converting a list of PDB files to a Sim trajectory is provided at the SaveXTC command.

Example 1:
SaveSim 1crn00000,2500

Save snapshots every 5ps (if time step is 2*1fs), as sim/1crn00000.sim (0ps), sim/1crn00001.sim (5ps) etc.


Example 2:
SaveSim Off

Disable saving of snapshots.