Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SaveSce

-

Save complete scene


CommandArgument DatatypeDefaultMinMax
Format:SaveSceFilename = Scene filenameSTRING - --
Python:SaveSce(filename)
Menu:File > Save as > Complete scene
Related: SaveMacro , SavePDB, SaveYOb , Save*, LoadSce
Required:


The SaveSce command saves the entire scene in a flat binary file that can be rapidly processed by YASARA, is 50% smaller than a comparable PDB file and contains specific features like labels or arrows that cannot be stored in normal PDB files.

To save a scene, all the objects must reside in their own local coordinate systems, which is not the case during a simulation. It is thus not possible to save a scene while a simulation is running, use SaveSim or SaveXTC instead.

If you additionally want to save images, simulation parameters or the properties of the YASARA window, look at the SaveMacro command.

Example:
SaveSce MyScene

Save the entire scene as sce/MyScene.sce (or just MyScene.sce if subdirectory sce is not present).