Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SavePOV

-

Save POVRay scene description


CommandArgumentDatatypeDefault Min Max
Format: SavePOV Filename = Filename of PovRay scene,STRING-- -
   Zoom = Ball zoom factor,FLOAT1.0- -
   Atoms = Balls | Blobs,STRINGBalls --
  LabelShadow = Yes | No, STRINGNo- -
   SecAlpha = Secondary structure alpha blending factor in percent FLOAT100.00.0100.0
Python:SavePOV(filename,zoom=None,atoms=None,labelshadow=None,secalpha=None)
Menu:Save as > Ray-traced screenshot > Create PovRay scene description only
Related:SaveBMP, RayTrace
Required:


The SavePOV command creates an input file for PovRay (www.povray.org ) to calculate a ray-traced view of the scene with realistic shadows.

When compared to the image on screen, the PovRay scene has the following shortcomings:

It is therefore suggested to use the RayTrace command instead, which does not only run PovRay directly, put also postprocesses the PovRay output to include the missing features listed above.

Look in the getting started section for instructions how to install PovRay.

Many additional hints and notes can be found at the RayTrace command.

Example 1:
SavePOV 1crn,1.2,Atoms=Blobs

Save a scene description for PovRay as pov/1crn.pov or 1crn.pov is subdirectory pov is not present, with all atoms 1.2 times the usual size, displaying all balls as smooth blobs.


Example 2:
SavePOV 1crn,1.2,Atoms=Balls,LabelShadow=yes,SecAlpha=50

As above, but show atoms as normal balls, let labels cast shadows, and show secondary structure half transparent.