Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SavePLI<Atom|Res|Mol|Obj>

-

Save plugin input file


CommandArgument DatatypeDefaultMinMax
Format:SavePLI<Atom|Res|Mol|Obj> Selection, SELECTION- - -
   Request = Name of request sent to pluginSTRING ---
Python: This command is mainly for internal use. It is not available in Python.
Menu:This command is mainly useful for macros. There is no menu entry.
Related:RunPlugin, StopPlugin
Required:


The SavePLI command is used internally to save an input file for the plugin, containing the selected atoms or residues. The input file is saved as plg/dat/input_(ProcessID).txt. There is normally no need to use the SavePLI command. Together with RunPlugin, SavePLI allows to run plugins from inside a Yanaconda macro.

Example:
SavePLIAtom 345-350,Request="GetEffect"

Save a plugin input file plg/dat/input_(pid).txt with the request "GetEffect" and selecting atoms 345 to 350.