Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SavePDB

-

Save Protein Data Bank file


CommandArgument DatatypeDefaultMinMax
Format:SavePDBObject selection, SELECTION---
  Filename = PDB filename,STRING - --
  Format = PDB | PDB3 | PDBRev | YASARA | IUPAC | XPLOR,STRINGPDB - -
   Transform = Yes | NoSTRING Yes --
Python:SavePDB(selection1,filename,format=None,transform=None)
Menu:File > Save as > PDB file
Related: SaveYOb , SaveSce, Save* , LoadPDB, Transform
Required:


The SavePDB command saves one or more objects in a single PDB file.

If multiple objects are saved together (e.g. a bundle of NMR structures), they will be separated with the 'MODEL' keyword. YASARA checks that the chemical connectivity of the objects is identical, as required by the PDB format standard. Since the atom coordinates in the PDB file are those from the local coordinate system, the objects should have the same global position and orientation , otherwise the PDB file may not reproduce what is visible on screen. To save different objects in a single PDB file, join them first.

The Format parameter sets the output format, which affects mostly the atom naming conventions: 'PDB' chooses the default PDB atom names, 'PDBRev' does the same but with reversed hydrogen numbering (at the end instead of the beginning), 'PDB3' chooses the new, but less consistent PDB V3 format, 'IUPAC' the very similar IUPAC naming conventions, 'YASARA' disables any atom name modifications and 'XPLOR' activates compatibility with the XPLOR program. The main problem with XPLOR is that it does not know chain IDs and relies on the segment ID in the right-most column to distinguish chains. YASARA therefore moves the chain ID to the segment ID if the latter is empty. If the PDB file to save contains both chain and segment IDs, the chain is usually more important. Use the command NameSeg all,____ to empty all segment IDs and allow them to be replaced by the chain IDs. Another format variant is the PQR format, which can easily be created with SavePDB , after the occupancy and B-factor fields have been filled with charges and radii .

If the Transform flag is set, all changes made to the local atom coordinates since the molecule was loaded (like centering) will be reversed. This makes sure that the atom coordinates stay unaltered on the way through YASARA.

Note that moving and rotating an object affects only the object coordinates in the global coordinate system, but not the individual atom coordinates in the object's local coordinate system. You simply would not expect that the atom coordinates change just because you look at the object from another side. In some rare cases however, you may want to save a PDB file with atom coordinates that reflect the current view . To do that, you have to transform the atom coordinates in the local coordinate system so that they match the current view in the global coordinate system .

If the original PDB file contained crystallographic information (CRYST1 record etc.), these data will be preserved in the saved file. However it is also possible to save the current simulation cell in a PDB file, disguised as a crystallographic unit cell: simply transfer the object into the cell to update its CRYST1 record before saving it: TransferObj 1,SimCell,Local=Fix.

If your structure contains more than ~100000 atoms the atom number in the PDB file overflows, because there is only space for five digits. The unfortunate consequence is that CONECT records, which are used to assign bonds between the atoms, become ambiguous. YASARA therefore adds CONECT information only for the first 100000 atoms.

Example 1:
SavePDB 2,1crn

Save object 2 as pdb/1crn.pdb (or just 1crn.pdb if subdirectory pdb is not present).


Example 2:
SavePDB 2,1crn,Format=Xplor

As above, but use Xplor atom names.


Example 3:
SavePDB 2,1crn,Format=YASARA

As above, but use YASARA atom names and do not number chemically equivalent hydrogens.


Example 4:
SavePDB 2,1crn,Transform=No

Use the current atom coordinates and do not reverse the transformation history.


Example 5:
SavePDB 1-10,Ensemble

Save objects 1-10 in PDB file 'Ensemble.pdb', each object as a separate model. The models will not necessarily share the same coordinate system.