Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SaveMacro

-

Save a macro to restore the current state


CommandArgument DatatypeDefaultMinMax
Format:SaveMacroFilename = Macro filename, STRING---
  Component = All | Scene | VisPar | Images | SimPar | WinParSTRING-- -
Python:SaveMacro(filename,component)
Menu:Options > Macro & Movie > Save macro
Related:SaveSce , SaveSim
Required:


The SaveMacro command creates a macro to restore selected parts of YASARA's current state.

While the SaveSce command saves all the objects and their visualization styles, there are a number of additional features that are not part of the scene. These features can be saved in a macro by passing one of the following parameters to the SaveMacro command:

  • Images: the images loaded with LoadBMP or LoadPNG and shown on screen.
  • SimPar: the current simulation parameters. If a simulation is running, YASARA will also save the atom velocities in a .sim file next to the .mcr file.
  • WinPar: the current size and configuration of the YASARA window.

For completeness, the scene can also be included:

  • Scene: the current scene. If this option is selected, YASARA will also save a .sce file next to the .mcr file.
  • VisPar: the visualization settings of the current scene.

Example 1:
SaveMacro restore,all

Save everything as mcr/restore.mcr (or just restore.mcr if subdirectory mcr is not present).


Example 2:
SaveMacro setsimparams,SimPar

Save the current simulation parameters as mcr/setsimparams.mcr.


Example 3:
SaveMacro graphics,Scene,Images,VisPar

Save everything related to graphics as mcr/graphics.mcr.