Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SaveMPG

-

Save MPEG video


CommandArgument DatatypeDefaultMinMax
Format 1:SaveMPGFilename = MPEG movie filename, STRING- - -
   X = movie X-resolution in pixels,INT640 - -
   Y = movie Y-resolution in pixels,INT480 - -
   FPS = frames per second in the final movie 23.976 | 24 | 25 | 29.97 | 30,STRING25--
  Quality = encoding quality, INT950 100
   skip = number of YASARA frames to skip per encoded frame, INT1--
  raytrace = Yes | No,STRING No --
  Menu = On | Off,STRING Off --
  justMacro = Yes | NoSTRING Yes --
Format 2: SaveMPG OffSTRING - --
Python:SaveMPG(filename,x=None,y=None,fps=None,quality=None,skip=None,raytrace=None,menu=None,justmacro=None)
SaveMPGOff()
Menu:File > Save as > MPEG movie
Keys:<Pause> or <P>  -  pause MPEG encoding
Related:SaveBMP, SavePOV , RayTrace
Required:


The SaveMPG command encodes the content of the YASARA window as an MPEG movie. Since the MPEG standard is heavily covered by software patents (see www.yasara.org/patents) YASARA supports only MPEG1 movies without audio, which also look better than MPEG2 at low bitrates.

MPEG movies are created by encoding whatever is shown in the YASARA window. The usual approach is therefore to write a YASARA macro/movie and add the SaveMPG command to the beginning of the macro. Alternatively, you can activate the MPEG encoding manually first and then run the macro. If the justMacro parameter is set, YASARA will only start encoding as soon as the macro is running.

As an example, the following macro rotates the scene in 180 steps around the Y-axis:


steps=180
for i=1 to steps
  Rotate Y=(360./steps)
  Wait 1

For highest quality output, every movie frame can be ray-traced with PovRay by setting the Raytrace parameter to 'Yes'.

With the exception of ray-traced movies, the YASARA window must be larger than the MPEG movie resolution. The window content will then be scaled down to the MPEG resolution before encoding. This scaling works best if the size of the encoded part of the window is an integer multiple of the MPEG movie resolution. Hints how to achieve that can be found in the section about YASARA movies.

If you set the Menu parameter to 'On' and the justMacro parameter to 'No', YASARA will really record everything, including the pull down menus as they are activated.

It is also possible to skip the actual MPEG encoding process and create a sequence of plain BMP images: just choose a movie filename with lots of zeroes and the extension '.bmp'. E.g. the filename MyMovie00000.bmp tells YASARA to save the movie frames as mpg/MyMovie00000.bmp, mpg/MyMovie00001.bmp etc.

Here are some general hints:

  • The bottom menu bar displays 'MPEG' while the SaveMPG command is active.

  • Switch the Console off to prevent it from appearing in the movie.

  • While encoding an MPEG movie, make sure that the YASARA window does not get covered by other windows or a screensaver. Depending on your OpenGL driver, the movie may then show whatever is on top of the YASARA window.

  • The <Pause> key pauses MPEG encoding.

  • If you choose a resolution of 704x480 pixels, the MPEG movie format will be set to NTSC, otherwise it is PAL.

  • If you create a ray-traced movie, the pop-up PovRay window may prevent mouse clicks from reaching the YASARA window. In this case, click on the YASARA window and enter the menu with keyboard shortcuts, e.g. <Alt>+<F>, then disable MPEG saving.

  • The PovRay parameters can be set separately by clicking on Save as > Raytraced screenshot. This includes an option to disable the PovRay window.

  • If you try to play the movie in Windows Media Player and get an error message about 'Class factory cannot supply requested class, code 80040111', you do not have proper MPEG support installed. Download Stinky's MPEG Codec from http://www.softpedia.com/progDownload/Stinkys-MPEG-Codec-Download-5661.html, version 1.2.0.79 was verified to fix this problem on a Windows XP system.

  • If part of the movie shows a sudden burst of compression artifacts, choose a different resolution or higher bitrate.

Example 1:
SaveMPG MyMovie,X=704,Y=576,FPS=25,skip=2

Save the next macro you run as a PAL MPEG movie mpg/MyMovie.mpg (or just MyMovie.mpg if subdirectory mpg is not present), recording every 3rd YASARA frame. If YASARA displays 75 frames per seconds, then the movie will run at the same speed.


Example 2:
SaveMPG MyMovie,X=704,Y=480,FPS=30,skip=1,Menu=On

As above, but create an NTSC movie and include all YASARA menus activated during the movie, recording every 2nd YASARA frame. If YASARA displays 60 frames per seconds , the movie will run at the same speed.


Example 3:
SaveMPG Tutorial,X=640,Y=480,FPS=25,skip=2,Menu=On,justMacro=No

Save everything including pull-down menus as you click them as a 640x480 MPEG movie 'Tutorial.mpg'.


Example 4:
SaveMPG Off

Disable movie encoding.