Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SaveBMP

-

Save screenshot as Windows bitmap


CommandArgumentDatatypeDefault Min Max
Format: SaveBMP Filename = BMP filename,STRING ---
   Menu = Yes | No,STRINGNo - -
   DepthMap = Yes | NoSTRING No --
Python:SaveBMP(filename,menu=None,depthmap=None)
Menu:File > Save as > Normal screenshot
Related:SavePOV, RayTrace
Required:


When saving a screenshot, YASARA uses OpenGL functions to read back the window content. Some OpenGL drivers (e.g. SiS M650) are broken and return a distorted image. Try to update your OpenGL driver or use the RayTrace command.

Example 1:
SaveBMP shot1

Save a screenshot as bmp/shot1.bmp (or just shot1.bmp if subdirectory bmp is not present).


Example 2:
SaveBMP shot1,Menu=Yes

As above, but include top and bottom menu lines if present.


Example 3:
SaveBMP shot1,DepthMap=Yes

Save a gray-scale depth map of the screen.