Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Save*

-

Export file with OpenBabel


CommandArgument DatatypeDefaultMinMax
Format:Save*Object selection, SELECTION---
  Filename = Molecule structure filename,STRING ---
   NameFormat = PDB | PDB3 | PDBRev | YASARA | IUPAC | XPLOR, STRINGPDBRev--
  Transform = Yes | NoSTRING Yes --
Python:This command is mainly for internal use. It is not available in Python.
Menu:File > Save as > Other fileformat
Related:SavePDB, SaveSce , SaveYOb, Load*
Required:


The Save* command invokes OpenBabel to export a molecule in the file format of another program. The star '*' stands for any of the supported file extensions, listed in the middle of the selection window that appears when you click File > Load > Other fileformat.

The NameFormat parameter sets the atom naming conventions, as described at the SavePDB command.

If you set the Transform flag, all changes made to the atom coordinates since the molecule was loaded (like centering) will be reversed. This makes sure that the atom coordinates stay unaltered on the way through YASARA.

If the force field has been initialized and point charges have thus been assigned, these charges are saved if the target format supports charges in the output. An example is the MOL2 format, which contains charges in the rightmost column. If the force field has not been initialized, these charges are determined by OpenBabel using the GASTEIGER scheme. Note that the name 'GASTEIGER' is always part of the output file, even if YASARA's own charges have been used.

Should you have problems exporting files, go to subdirectory bab/ and try to run babel/babel.app/babel.exe manually, e.g. convert your PDB file to an exotic format and look at the output. If that also does not work, please report the problem at http://openbabel.sourceforge.net.

Example 1:
SaveMOPCRT 3,1crn

Save object 3 as mopcrt/1crn.mopcrt (or just 1crn.mopcrt if subdirectory mopcrt is not present).


Example 2:
SaveMOL2 1,5tim,NameFormat=Xplor,Transform=No

Save object 1 as 5tim.mol2, choose Xplor atom names and use the current atom coordinates without reversing the transformation history.