Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Selections are not case sensitive except for two special cases

If you look into a PDB file, atom names consist of four characters, some of which are spaces. This creates some weird problems, like Calpha atoms being named " CA " and calcium atoms being named "CA ". By typing the first character in uppercase and the second character in lowercase, you tell YASARA that you want the latter, shifted form. So 'DelAtom CA' or 'DelAtom ca' deletes the Calpha atoms, while 'DelAtom Ca' deletes the calciums.

The second example involves the logical operators 'and' and 'or' which must always be lower case to distinguish them from residue or atom names.