Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Selections are inflated to the final selection type at the end

The final selection type (the command extension) plays a special role, because it determines what you get at the end. Even if you switch to a smaller selection type, your selection will be extended ('inflated') to the final type at the end.

Examples:
ColorRes Atom 123,Blue
Color the residue containing atom 123 blue (select atom 123 and inflate the selection to the entire residue)
ColorRes Atom CA,Red
Color residues with a CA atom red
DelMol B E Res Lys
Delete all molecules named 'B' or 'E' and containing a residue named Lys
RemoveObj Res His
Remove objects containing a His residue from the soup