Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Selections are defined by a final type and an expression

YASARA commands have a clearly defined format, which the Commands section describes in more detail. You can type commands directly in the console (press <SPACE> to enter, <RETURN> to leave). If the command involves a selection, the usual format is:


<Verb><Final selection type> <Selection expression>, <Argument2>....

Example:


ColorAtom CA CB,yellow

In this case, 'Color' is the verb and 'Atom' the final selection type. Together they define the name of the command, 'ColorAtom'. Because 'Atom' extends the meaning of the basic 'Color' command, it is also called the 'command extension'.

'CA CB' is the selection expression (the first argument to the command 'ColorAtom') and 'yellow' is the second argument. As commas ',' are used to separate command arguments, it is obvious that the selection expression must never contain commas .