Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RunPlugin

-

Run Python plugin


CommandArgument DatatypeDefaultMinMax
Format:RunPlugin Filename = Plugin filenameSTRING ---
Python: This command is mainly for internal use. It is not available in Python.
Menu:Options > Stop plugin
Related: StopPlugin
Required:


The RunPlugin command is used internally as soon as you click on a menu entry that activates a plugin. The input data for the plugin must be stored in plg/dat/input_(ProcessID).txt before the plugin is run. As all this is done automatically, there is normally no need to use the RunPlugin command. The extension of the plugin name is used to determine which plugin interpreter to run (currently only Python is supported).

Note that starting a plugin stops a running macro , so if you run a plugin from inside a macro , the macro will not continue afterwards. If the macro has to continue, consider using the Shell command instead of a plugin to run external programs.

Example 1:
RunPlugin ftppdb.py

Go to directory plg and run 'python ftppdb.py'.


Example 2:
RunPlugin color.mcr

Go to directory plg and run color.mcr as a simple macro.