Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Rotate<Obj|All>

-

Rotate objects or scene


CommandArgument DatatypeDefaultMinMax
Format:Rotate<Obj|All> Object selection,SELECTION ---
   X = Angle of rotation about X-axis in degrees, FLOAT0.0--
  Y = Angle of rotation about Y-axis in degrees,FLOAT 0.0 --
  Z = Angle of rotation about Z-axis in degreesFLOAT 0.0 --
Python:Rotate<Obj|All>(selection1,x=None,y=None,z=None)
Menu:Effects > Rotate
Related: Ori , AutoRotate, AutoRotateTo , Pos, Move , AutoMove, AutoMoveTo
Required:


The Rotate command rotates the selected objects about their three axes. First about X, then about Y and finally about the Z-axis.

If 'All' is selected, Rotate additionally moves all objects to create a rotation about the geometric center of the scene.

Example 1:
RotateObj 1crn,X=0.1

Rotate object 1crn by 0.1 degrees about the X-axis of YASARA's global coordinate system.


Example 2:
RotateAll Z=0.7

Rotate entire scene by 0.7 degrees about the Z-axis of YASARA's global coordinate system.