Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RestrainPot

-

Set/get restraining potential function


CommandArgumentDatatypeDefault Min Max
Format: RestrainPot Name = BiHarmonic | SquareWell | SoftSquare, STRING-- -
   SqConstant = Scaling constant in XPLOR units, FLOAT---
  SqOffset = Upper square-well distance offset in Å,FLOAT-- -
   SqExponent = Square-well exponent, INT-1 4
   rSwitch = Distance of switch to asymptote in Å ,FLOAT---
  SoExponent = Soft-square exponent, INT-14
   Asymptote = Slope of asymptote in XPLOR units,FLOAT ---
   Update = Yes | NoSTRINGYes - -
Python: RestrainPot(name,sqconstant,sqoffset,sqexponent,rswitch,soexponent,asymptote,update)
resultlist = RestrainPot()
Menu:Simulation > Restrain > Potential
Related: RestrainPar , RestEnergy, RestViol , ListRest, ScaleRest , LoadTbl, RestrainDis , RestrainDih, ShowRest , HideRest, DelRest
Required:and the NMR Structure Determination Module


The RestrainPot command defines the potential energy function used to restrain interatomic distances. If the Update flag is set, all currently defined restraints will be updated to the new potential function, otherwise only those added afterwards. This mechanism allows to work with different restraining functions at the same time.

The definitions of the three functions as well as the parameters are the same as in the XPLOR program. The units of the parameters are Angstrom for distances and 'XPLOR units' for the rest, indicating that they are not clearly defined but depend on the potential functions and exponents used.

Each restraining function requires three additional parameters named d, dminus and dplus, which are set individually for each restraint by the RestrainDis or LoadTbl commands.

  • The Biharmonic potential (equation 1) has its minimum at distance d, with a harmonic function on either side, scaled by parameters 1/dminus^2 (for distances R < d) and 1/dplus^2 (for distances R > d):


(1)

where Kb is the Boltzmann constant, T is the simulation temperature, Ceil is the maximum scaling factor for distance restraints set with the RestrainPar command, Scale is a scaling factor set afterwards with the ScaleRest command, and cij is defined in equation 2:


(2)

The Biharmonic potential is of limited use for NMR structure determination, because large violations cause enormous energies and thus forces, which can easily blow up a simulation. Nevertheless it is useful for adding other kinds of restraints, similar to the AddSpring command.

  • The Square-well potential is an extension of the biharmonic potential, where the energy minimum (and thus the absence of any restraining forces) is stretched out to the distance range [d-dminus .. d+dplus-SqOffset]. In addition, the exponent is not always 2, but can be chosen in the range [1..4]:


(3)

where Ceil is the maximum scaling factor set with the RestrainPar command, Scale is the current scaling factor changed at anytime for certain restraints with the ScaleRest command, SqConstant , SqExponent and SqOffset are parameters of this command, and Delta is defined below:


(4)

The square-well potential is better suited for structure determination since restraining forces can be limited to distances that are clearly ruled out by experimental data. Still the potential is hardly useful for folding a peptide chain from the stretched-out conformation or for handling incorrect restraints, because large violations can result in enormous energies and forces (if SqExponent > 1).

  • The Soft-Square Potential solves the remaining issues by replacing the outer part of the square-well potential beyond the distance d+dplus-SqOffset+rSwitch with a linear function. The attractive force (i.e. the first derivative) is then constant beyond this distance, avoiding excess forces and simulation failures:


(5)

and
(6)

where Ceil and Scale are set by the RestrainPar and ScaleRest as described above, SqConstant, SqExponent, SqOffset, SoExponent, Asymptote and rSwitch are parameters of this command, Delta is defined in equation 4 above and a and b are chosen by YASARA such that energy and force are both continuous functions at the distance d+dplus-SqOffset+rSwitch.

Example 1:
RestrainPot

Display the restraining potential currently in use.


Example 2:
RestrainPot BiHarmonic

Choose a biharmonic potential for all restraints.


Example 3:
RestrainPot BiHarmonic,Update=No

As above, but do not modify restraints that are already present.


Example 4:
RestrainPot SquareWell,SqConstant=2,SqOffset=0.5,SqExponent=2

Choose a square-well potential for all restraints.


Example 5:
RestrainPot SoftSquare,SqConstant=1,SqOffset=0,SqExponent=2,rSwitch=1,SoExponent=1,Asymptote=2

Choose a soft square-well potential for all restraints.