Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RestrainPar

-

Set/get restraining parameters


CommandArgumentDatatypeDefault Min Max
Format: RestrainPar Average = R-6 | R-3 | Sum | Center,STRING-- -
   Ceil = Maximum product of scaling factors for distance restraints, FLOAT---
  DisMin = Distance restraint lower bound d-dminus in Å,FLOAT - --
  Monomers = Number of monomers in sum averging,INT- - -
   JoinDis = Distance from geometric center of equivalent protons where the visualized distance restraints join, FLOAT---
  FloatGroups = Percentage of atom groups that are checked each simulation step to optimize floating assignments FLOAT---
Python:RestrainPar(average,ceil,dismin,monomers,joindis,floatgroups)
resultlist = RestrainPar()
Menu:Simulation > Restrain > Parameters
Related:RestrainPot , RestEnergy, RestViol , ScaleRest, ListRest , LoadTbl, RestrainDis , RestrainDih, ShowRest , HideRest, DelRest
Required:and the NMR Structure Determination Module


The RestrainPar command sets a number of global parameters related to restraints.

The Average parameter defines how distances between groups of (usually) equivalent atoms/spins are calculated. Typical groups are three methyl hydrogens or two methylene hydrogens. Some of these averaging methods require to adjust the upper bounds of restraints, e.g. center averaging needs a pseudoatom correction. YASARA does not make any such modifications by itself, but instead assumes that the restraints you specify are already appropriate for the chosen averaging function.

  • Average=R-3: The current distance is averaged according to equation 1, where Rij runs over all n1*n2 permutations of distances between the n1 atoms on one side of the restraint, and the n2 atoms on the other side.


(1)

  • Average=R-6: As above, except that the sixth instead of the third power is used (equation 2), which better reflects the underlying physics.


(2)

  • Average=SUM: Activates R-6 summation, a more recently introduced variant of R-6 averaging, where the averaging step is omitted (equation 3) and an additional scaling factor for the number of monomers in symmetric oligomers is included.


(3)

  • Average=Center: Activates center averaging, where the current distance is simply the distance between the geometric centers of the equivalent atoms on either side of the restraint (equation 4). XPLOR uses a slightly modified approach, hence the calculated violation energies may differ between the two programs. Center averaging is hardly used anymore.


(4)

The Ceil parameter is the same as in XPLOR and defines the ceiling value for energy constants.

The Monomers parameter sets the number of chains in a symmetric oligomer, which is required by the sum averaging approach.

The DisMin parameter explicitly sets the lower bound d-dminus for all distance restraints enforced by square-well or soft-square potentials. Two typical applications are to remove all lower bounds by setting DisMin to 0, or to add minimum lower bounds by setting DisMin to 2. If DisMin is set to -1, the parameter is ignored and the individual lower bounds of each restraint are used.

The JoinDis parameter adapts the graphical display of restraints. If JoinDis is below zero, YASARA draws one single line for every restraint, linking the geometric centers of the two involved atom groups. If JoinDis is greater than zero, YASARA additionally draws one line from every atom, joining at a point that is JoinDis Angstrom away from the geometric center, in the direction of the other group.

The FloatGroups parameters specifies the percentage of atom groups that are analyzed and potentially swapped each simulation step (just before the restraint forces are calculated) to optimize floating assignments . The groups to be analyzed are picked randomly, except if 'FloatGroups' is set to 100%, in which case all groups are analyzed sequentially.

Example 1:
RestrainPar

Display the current restraining parameters.


Example 2:
RestrainPar Average=Sum

Use sum averaging to determine the current distance.


Example 3:
RestrainPar Ceil=3

Allow at most 3 for the product of all distance restraint scaling factors.


Example 4:
RestrainPar DisMin=0

Remove the lower bounds of all distance restraints.


Example 5:
RestrainPar JoinDis=1.5

When visualizing distance restraints, let the lines from restrained atom groups join 1.5 A from their geometric center.


Example 6:
RestrainPar JoinDis=-1

Do not draw restraints with joining lines, show only single lines between the geometric centers of atom groups.


Example 7:
RestrainPar FloatGroups=1%

After each simulation step, swap 1% of all pairs of equivalent atom (group)s if that improves the fit to the restraints.