Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RestrainDis

-

Restrain distance


CommandArgument DatatypeDefaultMinMax
Format:RestrainDis Atom selection 1, SELECTION- - -
   Atom selection 2,SELECTION - --
  Class = Name of restraint class, STRING---
  d = restraining distance in Å,FLOAT - --
  dminus = restraining parameter 1,FLOAT---
  dplus = restraining parameter 2FLOAT---
Python:RestrainDis(selection1,selection2,Class,d,dminus,dplus)
Menu:Simulation > Restrain > Distance
Related:LoadTbl, RestrainDih , RestrainPot, RestrainPar , RestEnergy, RestViol , ScaleRest, ListRest , ShowRest, HideRest , DelRest
Required: and the NMR Structure Determination Module


The RestrainDis command adds a distance restraint between the two selected atoms or groups of atoms. The restraining parameters d, dminus and dplus configure the restraining potential and are described in detail here .

If more than one atom (i.e. an atom group) is selected on either side of the restraint, the distance is calculated using a distance averaging function .

During a simulation, restraints exert a pulling/pushing force, and during an internal coordinate folding run , they are part of the energy function .

If a large number of restraints is needed, e.g. for NMR structure determination, they can be loaded directly from a file in XPLOR format .

The restraints can be shown or hidden on screen and deleted. They are not part of the scene and therefore not affected by undo/redo and not saved with SaveSce. Restraints are deleted automatically when the object they belong to is modified.

Satisfied restraints are drawn green, violated ones red. They can be styled using the PointPar command and the JoinDis option of the RestrainPar command.

Example 1:
RestrainDis 1000,2000,d=5,dminus=1.2,dplus=3

Add a distance restraint between atoms 1000 and 2000 using the the current restraining potential with parameters 5, 1.2 and 3.


Example 2:
RestrainDis HB Res Ala 50,HD? Res Leu 60,d=8,dminus=4.2,dplus=5

Add a distance restraint between the three HB hydrogens of Ala 50 and the six HD1/HD2 hydrogens of Leu 60. Note that YASARA does not number equivalent hydrogens.