Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RestrainDih

-

Restrain dihedral angle


CommandArgument DatatypeDefaultMinMax
Format:RestrainDih Atom selection 1, SELECTION- - -
   Atom selection 2,SELECTION - --
  Atom selection 3,SELECTION - --
  Atom selection 4,SELECTION - --
  Class = Name of restraint class, STRINGAll--
  C = restraining energy constant in kcal/(mol*rad^2), FLOAT1.0 - -
   Equil = Equilibrium angle in degrees,FLOAT ---
   Delta = allowed plus/minus range in degrees, FLOAT---
  Exponent = restraining energy exponentFLOAT 2.0--
Python: RestrainDih(selection1,selection2,selection3,selection4,Class,c,equil,delta,exponent=None)
Menu:Simulation > Restrain > Dihedral
Related:RestrainDis, LoadTbl , RestrainPot, RestrainPar , RestEnergy, RestViol , ScaleRest, ListRest , ShowRest, HideRest , DelRest
Required: and the NMR Structure Determination Module


The RestrainDih command adds a dihedral angle restraint to the four selected atoms, that forces this dihedral to fall into the range Equil+/-Delta during a simulation or internal coordinate folding run .

The restraining function is the same as used by XPLOR:


(1)

and
(2)

where Phi is the current dihedral angle, the scaling factor Scale can be modified afterwards with the ScaleRest command, while the individual scaling factor C, the equilibrium dihedral angle Equil, the allowed deviation Delta, and the Exponent are set directly by this command or read from a restraint file in XPLOR format . For clarity, the fact that differences between dihedral angles must consider the wrap-around at +/-180 degrees has been omitted from equation 2.

The restraints can be shown or hidden on screen and deleted. They are not part of the scene and therefore not affected by undo/redo and not saved with SaveSce. Restraints are deleted automatically when the object they belong to is modified.

Satisfied restraints are drawn green, violated ones red. They can be styled using the PointPar command and the JoinDis option of the RestrainPar command.

Example:
RestrainDih C Res 10,N Res 11,CA Res 11,C Res 11,C=2.0,Equil=-50,Delta=20

Restrain the backbone dihedral angle 'Phi' of residue 11 to -50+/-20 degrees with an energy constant of 2 kcal/(mol*rad^2).