Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RestViol<Obj|All>

-

Get restraint violation statistics


CommandArgument DatatypeDefaultMinMax
Format:RestViol<Obj|All>Selection SELECTION---
Python:resultlist = RestViol<Obj|All>(selection1)
Menu:Simulation > Restrain > Violation statistics
Related:RestEnergy, ListRest , LoadTbl, RestrainDih , RestrainPot, RestrainPar , ScaleRest, ShowRest , HideRest, DelRest
Required:and the NMR Structure Determination Module


The RestViol command outputs violation statistics for distance and dihedral angle restraints : First the sum of all violations and second the maximum violation (in units of Angstrom for distances and degrees for dihedrals).

This feature is useful for rejecting structures with particularily large violations early in the refinement procedure. In the end, the ensemble is usually sorted based on the restraint violation energy .

Example 1:
RestViolAll

Get maximum and summed up distance and dihedral angle violations.


Example 2:
dissum,dismax,dihsum,dihmax = RestViolObj 3

As above but for object 3 only, and assign the results to the four specified variables.


Example 3:
viollist() = RestViolObj all

Get the violations for all objects individually and assign them to list 'viollist'.