Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RestEnergy<Obj|All>

-

Calculate restraint energies


CommandArgument DatatypeDefaultMinMax
Format:RestEnergy<Obj|All> Selection,SELECTION - --
  Component = All | Distance | DihedralSTRINGAll - -
Python: resultlist = RestEnergy<Obj|All>(selection1,component=None)
Menu: Simulation > Restrain > Violation energy
Related: Energy , EnergyUnit, SolvEnergy , ScaleRest, ListRest , ShowRest, HideRest , DelRest, LoadTbl , RestrainDis, RestrainDih , RestrainPot, RestrainPar
Required:and the NMR Structure Determination Module


The RestEnergy command calculates the current energy of distance- and/or dihedral-angle restraints according to the chosen potential function .

Results are returned in units of either kJ/mol or kcal/mol, depending on the current EnergyUnit.

Example 1:
RestEnergy

Calculate the energy of all restraints.


Example 2:
RestEnergyObj 5 7

Calculate the energies of the restraints in objects 5 and 7.


Example 3:
dihenergy = RestEnergyObj 1crn,Dihedral

Calculate the energy of the dihedral angle restraints in object 1crn and assign it to variable 'dihenergy'.


Example 4:
energylist() = RestEnergyObj all,Distance

Calculate the distance restraint energies for all objects and assign the results to the list 'energylist'.