Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ResonateBond

-

Introduce fractional bond orders


CommandArgumentDatatypeDefault Min Max
Format: ResonateBond Atom selection 1,SELECTION ---
   Atom selection 2SELECTION ---
Python: ResonateBond(selection1,selection2)
Menu:Edit > Adjust bond orders > Resonate bond
Related:KekulizeBond, TypeBond , AddBond, DelBond , Link
Required:


The ResonateBond command reverses the changes made by KekulizeBond: Bonds between selected atoms are scanned for patterns of alternating single/double bonds and replaced by the proper resonance form.

Two typical examples:
  • Deprotonated carboxyl groups: If one oxygen makes a double bond and the other one a single bond, ResonateBond will change the order of both bonds to 1.5 (shown in red).
  • Aromatic rings like benzene: If conjugated single/double bonds are present, ResonateBond will make all bonds identical (bond order 1.5).

Note: the choices that have to be made by the ResonateBond command are ambiguous if hydrogen atoms are missing. In such a case it is better to just retype the bonds, which also considers the pH dependency of missing hydrogen atoms.

The ResonateBond command is especially useful after loading molecules in a format that does not support fractional bond orders (e.g. mol2), since it makes sure that chemically equivalent atoms are also perceived as such - which is in turn important for commands like Sup or RMSD which flip chemically equivalent atoms to minimize RMSDs.

More details about fractional bond orders can be found here .

Example 1:
ResonateBond all,all

Replace alternating single/double bonds with the corresponding fractional bond order, e.g. 1.5 in benzene rings.


Example 2:
ResonateBond CZ Res Arg,NE NH? Res Arg

Make sure that the bond orders between atoms CZ and NE,NH1,NH2 in arginines are 1.33.