Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Residue

-

any continuous stretch of atoms sharing the same residue name, residue number and molecule name

Note the word 'continuous'. If you split a residue in the middle (corresponding to a TER entry in the PDB file), you will end up with two separate residues.

The scourge of molecular modeling is the 'residue numbering problem'. PDB files provide space for residue numbers up to 9999. What if there are more than 9999 residues? What if there are several residues with the same number? Most programs answer these questions by introducing a second numbering scheme, so that you have to remember two different numbers per residue. YASARA provides an easy solution: the PDB residue number is the one and only, ambiguities are resolved with the selection language and its new concept 'selection inflation':

DelRes 300
Delete residue with PDB number 300

If there is more than one residue with this number, YASARA will delete all of them. What if you want to select only one of these residues?

DelRes 300 Mol B
Delete residue with PDB number 300 in molecule (=chain) B

And finally, what if molecule B contains more than one residue with number 300? As peptide chains are generally shorter than 9999 residues, this hardly ever happens. If it does, select one of the atoms in the residue and use selection inflation :

DelRes Atom 13747
Delete the residue which contains atom 13747

Atom numbers are always unique in YASARA.

Figure: One single arginine residue, created with the BuildRes command.