Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Reset

-

Reset YASARA to startup state


CommandArgumentDatatypeDefault Min Max
Format: Reset - --
Python:This command is mainly for internal use. It is not available in Python.
Menu:File > New
Related: Clear , DelAll
Required:


The Reset command sets YASARA back to the initial state, just as if you restarted the program.

In addition to the tasks performed by Clear, Reset also empties the undo-history, sets all simulation parameters back to the initial state and stops any running macros and plugins. Macros and plugins should therefore not use the Reset command.

Example:
Reset

Clear the entire scene including the undo history and reset the simulation parameters.