Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RequireVersion

-

Require a minimum YASARA version


CommandArgumentDatatypeDefault Min Max
Format: RequireVersion Number = YASARA version numberSTRING ---
Python: This command is mainly for internal use. It is not available in Python.
Menu:This command is mainly useful for macros. There is no menu entry.
Related:PlayMacro, OnError
Required:


New features are added to YASARA continuously (www.yasara.org/changelog). If your movie uses some of the new commands, it is helpful to check if the required YASARA version is present, so that the user gets a meaningful error message right in the beginning and not an 'Unknown command' error somewhere near the end of your movie.

Example:
RequireVersion 3.10.26

Display an error message if the current YASARA version is older than 3.10.26.