Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RenumberRes

-

Renumber residues


CommandArgument DatatypeDefaultMinMax
Format:RenumberRes Selection,SELECTION - --
  first = Number of first residue, INT1--
  InsCode = Insertion codeCHAR _ --
Python:RenumberRes(selection1,first=None,inscode=None)
Menu:Edit > Renumber > Residue
Related: Name , RenumberObj
Required:


The RenumberRes command changes the numbers of the selected residues, optionally including the insertion codes.

Example 1:
RenumberRes Obj 1crn,5

Renumber residues in object 1crn, first residue gets number 5.


Example 2:
RenumberRes 3-5,3,A

Renumber residues 3,4 and 5 to 3A,3B and 3C.


Example 3:
RenumberRes 3-6,3,Y

Renumber residues 3,4,5 and 6 to 3Y,3Z,4 and 5.