Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Renumber<Obj|All>

-

Renumber objects


CommandArgument DatatypeDefaultMinMax
Format:Renumber<Obj|All> Object selection,SELECTION ---
   first = New number of first selected objectINT1--
Python:Renumber<Obj|All>(selection1,first=None)
Menu:Edit > Renumber > Object
Related: SwapObj , RenumberRes
Required:


The RenumberObj command changes the numbering of selected objects in the scene . It is mainly used to close gaps that appear in the object HUD after individual objects have been deleted.

Example 1:
RenumberObj all

Renumber all objects in the scene sequentially starting from 1, i.e. close any gaps in the object list.


Example 2:
RenumberObj 5-10,12

Renumber objects 5 to 10 so that they take positions 12 to 17.