Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Remove<Obj|All>

-

Remove objects from the soup


CommandArgumentDatatypeDefault Min Max
Format: Remove<Obj|All> Object selectionSELECTION ---
Python: Remove<Obj|All>(selection1)
Menu:Edit > Remove > Object
Related: DelObj , AddObj
Required:


The specified objects are removed from the soup, for example to exclude them from a simulation without having to delete them. They can be added again later with AddObj. For more details, look in the essentials section .

Example:
RemoveObj 1crn 4 5-10

Remove objects 1crn, 4 and 5 to 10.