Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RemoveEnv<Atom|Res|Mol|Obj|All>

-

Remove from environment for surface calculations


CommandArgument DatatypeDefaultMinMax
Format:RemoveEnv<Atom|Res|Mol|Obj|All> Selection SELECTION- - -
Python: RemoveEnv<Atom|Res|Mol|Obj|All>(selection1)
Menu:Edit > Remove > from environment
Related:AddEnv, ShowSurf , HideSurf, ColorSurf , Surf, SurfPar
Required:


All selected atoms are removed from the environment that is considered when showing surfaces or calculating surface areas.

More details can be found at the AddEnv command.

Example 1:
RemoveEnvAll

Consider only selected atoms and ignore all the others when showing surfaces and calculating surface areas.


Example 2:
RemoveEnvRes HOH

Ignore all waters when showing surfaces and calculating surface areas of other residues.


Example 3:
RemoveEnvMol B

Ignore molecule B when showing surfaces and calculating surface areas of other molecules.