Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Regularize<Obj|All>

-

Regularize covalent geometry


CommandArgument DatatypeDefaultMinMax
Format:Regularize<Obj|All> Object selection, SELECTION- - -
   Sigmas = Number of maximally allowed standard deviationsFLOAT2.00.1 10.0
Python:Regularize<Obj|All>(selection1,sigmas=None)
Menu: Edit > Geometry > Regularize
Related:Distance , Angle, Dihedral
Required:


The Regularize command maps to WHAT IF's REFI option. It moves the atoms in the selected object iteratively until the bond lengths, bond angles and chiralities do not deviate more than the specified number of standard deviations (sigmas) from the mean. The mean corresponds to the Engh&Huber parameters for X-ray refinement.

Contrary to a normal energy minimization , Regularize does not consider intermolecular interactions and will thus not remove bumps. This is helpful to check how many additional bumps have to be introduced to satisfy the covalent geometry.

Example 1:
RegularizeObj 1crn

Regularize bond lengths and bond angles in object 1crn.


Example 2:
RegularizeObj 1crn,Sigmas=3

As above, but make sure that bond lengths and angles fall only within 3 sigmas of the standard values (looser than default).