Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Redo

-

Redo changes


CommandArgument DatatypeDefaultMinMax
Format:RedoSteps = Number of steps to redo INT1 - -
Python: This command is mainly for internal use. It is not available in Python.
Menu:Edit > Redo
Keys:<Ctrl>+<R>  -  Redo the last undone edit step
Related:Undo, UndoLevels
Required:


The Redo command perfoms the specified number of editing steps a second time after they have been Undone.

More details can be found at the Undo command.

Example:
Redo 3

Redo the last three edit steps undone before.