Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RecordMacro

-

Record all following commands in a macro


CommandArgumentDatatypeDefault Min Max
Format: RecordMacro Filename = Macro filename,STRING ---
   append = Yes | NoSTRINGNo - -
Python: This command is mainly for internal use. It is not available in Python.
Menu:Options > Macro & Movie > Record
Related:PlayMacro, StopMacro
Required:


Use StopMacro to stop recording. A recorded macro contains all commands issued via the window manager, the console or the function keys, but no mouse-movements. So if you want to change an object's position or orientation, use the commands from the Effects menu. Macros can also be written directly using a text-editor and the Yanaconda macro language.

Example:
RecordMacro MDSimulation

Save all commands to macro mcr/MDSimulation.mcr (or just MDSimulation.mcr if subdirectory mcr is not present).