Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RecordLog

-

Record all console output in a log file


CommandArgumentDatatypeDefault Min Max
Format: RecordLog Filename = Log filename,STRING ---
   append = Yes | NoSTRINGNo - -
Python: RecordLog(filename,append=None)
Menu:Options > Log > Record
Related: StopLog , LogAs, RecordMacro
Required:


A log contains the entire output printed to the console.

If you switch the console off, only the output of commands will be printed and recorded.

Example 1:
RecordLog my

Save all console output to log/my.log (or just my.log if subdirectory log is not present).


Example 2:
RecordLog my2,append=Yes

Save all output to log/my2.log, appending to existing file.