Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Ranges can be specified with a minus sign

If you want to select a range of items, separate the first and last item with a minus sign '-'.

Examples:

ColorAtom 350-385,Red
Color atoms with numbers 350 to 385 red
ColorRes 30-40,Blue
Search for a residue with number 30, then color all residues blue until residue number 40 in the same molecule
ColorRes Lys 30-Asp 40,Blue
Search for a residue named 'Lys 30', then color all residues blue until 'Asp 40' in the same molecule
DelMol B-E
Delete all molecules named 'B','C','D' or 'E'
RemoveObj 4-6
Remove objects 4, 5 and 6 from the soup