Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Reporting bugs, problems and inconveniences

If you have Python installed, the easiest way of reporting a problem is by clicking on Help > Report error.

The second option is to do it manually at www.yasara.org/bugreport . If the problem requires more than a few mouse clicks to reproduce, please send us the corresponding execution log. YASARA logs all commands in the log/ subdirectory with names like log/exec_XY.log, where XY is the process ID. When YASARA exits, the log file is automatically deleted.

  • If YASARA crashes there is no time to delete the log file, so you can just send the newest log file you find.

  • If the problem does not involve a crash, do not exit YASARA, otherwise the log file will be lost. Either get the latest log file while YASARA is still running or type
    CoreDump
    
    in the console to force a crash and preserve the log file.

  • If you experience a true crash in Linux which is not caused by a bug in YASARA but by some specific characteristics of your computer (e.g. a crash immediately when you start YASARA), please analyze it in more detail. Open a terminal and type
    
    ulimit -c unlimited
    
    
    Then start YASARA from the terminal and cause the crash. You should now see a message like
    
    Segmentation fault (core dumped)
    
    
    ..and there should be a file named core.[ProcessID] in your current directory (if you started a macro that changed the working directory, you have to go there first). Run the GNU debugger with these commands:
    
    gdb [PathToYASARA]/yasara core.[ProcessID]
    info stack
    info registers
    disass
    
    
    Please email us the information displayed in the terminal.