Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Running a simulation

As soon as the force field can cope with your structure, you are ready to run a simulation. Step-by-step instructions can be found in the help movie 'Accurate Simulations in Water'. Described below is the quickest way of running a simulation.

  • Create a project directory 'MyDir'.

  • Store either a PDB file (MyStructure.pdb) or a YASARA scene file (MyStructure.sce) of your structure there. Scene files must contain a simulation cell, and should therefore be used if you want to place the cell yourself.

  • Click Options > Macro & Movie > Set target and choose MyDir/MyStructure.pdb as the target.

  • Click Options > Macro & Movie > Play and choose your favorite molecular dynamics macro, e.g. md_run.mcr. If you do not like the default parameters, open yasara/mcr/md_run.mcr with a text editor, make the required changes and save it under a different name.

  • Wait and see how the simulation goes. The standard MD macros will take care of 'everything': Cleaning your structure, creating a simulation cell, filling it with water, placing counter ions, predicting pKa values and assigning protonation states, calibration, saving snapshots at regular intervals etc.

  • By default, YASARA updates the screen after each simulation step. While this approach maximizes interactivity, it also slows down the simulation. Click Simulation > Time step and increase the number at 'Update the display every...'. Note that this makes YASARA respond more slowly. Alternatively, you can run a simulation in console mode.

  • If you stopped a simulation and want to continue later, just play the md_run.mcr a second time.

To give you a reference point for the speed to expect: A simulation of Crambin (1CRN) using the default macro md_run.mcr with ~10000 atoms proceeds by 1 picosecond per minute or 1.44 nanoseconds per day on an AMD Opteron 1.8 GHz.

Figure: Crambin, ready for simulation in a water box

A note on simulating proteins with a net charge : the Particle Mesh Ewald algorithm used to calculate long range electrostatic interactions requires that the net charge of the simulation cell is zero, just like the charge of macroscopic objects in the real world. The macro md_run.mcr described here achieves this goal by adding counter ions to the system using the Neutralization Experiment, e.g. if the protein's net charge is negative due to excess Asp and Glu residues, YASARA will add Na+ ions to compensate.