Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Refine a homology model

To refine a homology model with YASARA, you need:

  • YASARA Dynamics.
  • The homology model, built for example with WHAT IF in the Twinset.

There are two tested ways of improving a homology model, i.e. reducing the RMSD between the model and the target.

° 

The quick method: in vacuo energy minimization with the NOVA force field

This method is described in the article Increasing the precision of comparative models with YASARA NOVA - a self-parameterizing force field , Proteins 47,393-402:

  • Click File > Load > PDB file to load the homology model.
  • Click Simulation > Force field and select the NOVA force field with a 10.24 A force cutoff.
  • Click Options > Choose experiment > Energy minimization and wait until the procedure is completed.

If your homology model contains unusual ligands, you may have to add NOVA force field parameters.

° 

The slow method: explicit solvent molecular dynamics simulation with the YAMBER force field

This method is described in the article Making optimal use of empirical energy functions: force field parameterization in crystal space Proteins 57,678-683:

  • Create a project directory 'MyDir'.

  • Store a PDB file of your model there (MyStructure.pdb).

  • Click Options > Macro & Movie > Set target and choose MyDir/MyStructure.pdb as the target.

  • Click Options > Macro & Movie > Play and choose md_refine.mcr.

  • Wait until the 500 ps simulation is finished.

As described in the publication cited above, this method does not work for all models, there are some which move in the wrong direction. These cases can be detected by looking at the structural quality (force field energy, Ramachandran plot, packing). YASARA will therefore analyze the snapshots at the end and save the results as a table, so that the lowest energy structure can be easily identified. If you have the Twinset installed, this table will also contain the above mentioned WHAT IF quality indicators.