Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Radius<Atom|Res|Mol|Obj|All>

-

Calculate the VdW radius


CommandArgument DatatypeDefaultMinMax
Format:Radius<Atom|Res|Mol|Obj|All> Selection SELECTION- - -
Python: resultlist = Radius<Atom|Res|Mol|Obj|All>(selection1)
Menu: Analyze > Radius of
Related:Distance, Angle , Dihedral, Mass
Required:


The Radius command calculates the radius of a sphere located at the geometric center of the selection that encloses the complete selection.

If the selection consists of just a single atom, the result is simply the Van der Waals radius of this atom.

Calculations are based on YASARA's standard Van der Waals radii except when a force field (excluding NOVA) has been initialized. In this case, the command works with the Van der Waals radii defined by the force field.

Example 1:
RadiusAtom 126

Get the Van der Waals radius of atom 126.


Example 2:
RadiusRes Gly 34

Get the radius of the Van der Waals sphere placed at the center of residue Gly 34 that completely encloses this residue.


Example 3:
radius = RadiusObj 1crn

As above for the entire object 1crn, and assign the result to variable 'radius'.


Example 4:
radiuslist() = RadiusAtom Obj 1crn

Assign the Van der Waals radii of all atoms in object 1crn to list 'radiuslist'.