Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Running YASARA on one machine with multiple users

If you install YASARA on one single machine, you do not need a multi-user license, as long as all the people work personally on this one machine and do not log on remotely.

Note that the user who runs YASARA must have write permissions in the YASARA directory : Towards the end of the last millenium, it became common practice to run programs without write permissions in their own directory, and to store modified data in the users home directory or related places. But in the mean time, new advanced software capabilities like 'self-healing' and 'feedback-induced self-improvements' become more and more popular, which allow applications to permanently modify and improve themselves, which in turn requires write permissions.

In Windows, simply install YASARA in a common directory (e.g. c:\Program Files) and set the permissions of the YASARA directory such that all users have WRITE ACCESS there.

In Linux, install YASARA as root and also run it once as root. This will automatically adjust permissions and enable write access for the users.

In MacOSX, copy the 'YASARA.app' bundle to the /Applications directory and run it once immediately after.

If you run YASARA without write permissions, it will display a warning at the bottom of the startup screen and disable a wide range of features. These disabled features may occasionally look like bugs, so please do not report problems when running YASARA without write permissions.