Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Running YASARA on a 64 bit operating system

With the extension of the common x86 CPU architecture to 64 bits by AMD and later also Intel, true 64 bit computing is now available even on low-end PCs. However, YASARA is not an application that benefits in any way from more than about 1 GB of memory, so the main advantage of 64 bits - the larger address space - is not a help. What remains is the larger number of CPU registers, which allows the compiler to create more efficient code - unfortunately at the cost of slower memory accesses, because all pointers now occupy an additional 32 bits in the data cache. Since all critical sections of YASARA have been implemented in Assembly language anyway, we do not expect any noticeable benefit from 64 bits. For simplicity, YASARA will therefore stick to 32 bits, as long as all 64 bit operating systems keep their support for running 32 bit applications.

In short: YASARA normally runs out of the box on 64 bit operating systems. Exceptions include some less user friendly Linux distributions (e.g. Kubuntu) that may require you to install additional RPMs to add 32 bit versions of some system libraries.