Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Running YASARA from an NFS mounted volume

If you own a group-leader license of YASARA, you can install the program on an NFS mounted harddrive.

While it makes sense for many programs to run them directly from the NFS partition, this is not an efficient solution for YASARA due to a couple of reasons:

  • YASARA is not a static program which gets away with a single .ini file that is stored separately for each user. A large number of files are modified while YASARA is running (force field definition files, caching files, plugin communication data, log files).

  • Changes made by one user to the force fields can easily mess up the work of others.

  • The amount of data read from/written to the YASARA directory quickly exceeds the NFS network bandwith, especially when working with protein databases in YASARA Structure and the Twinset.

The solution is to use the Python script rsync.py , which can be found in the yasara/plg directory. Open this script in a text editor and adjust the settings for the first two directories 'masterdir' and 'localdir', then run it on every machine where you want to install YASARA.

The script creates a local copy of the NFS mounted YASARA folder, preserves the config file yasara.ini, warns the user when important force field definition files got overwritten and offers to restore them.

When YASARA got updated on the NFS volume, users can simply rerun the script.

This approach makes sure that everyone can work with YASARA at full speed, while keeping other users safe from local modifications.