Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RMSF<Atom|Res|Mol>

-

Calculate root mean square fluctuations


CommandArgument DatatypeDefaultMinMax
Format:RMSF<Atom|Res|Mol>Unit = A | BFactorSTRING BFactor--
Python: resultlist = RMSF<Atom|Res|Mol>(unit=None)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:AddPos, AveragePos, RMSD , Sup
Required:


The RMSF command calculates the final root mean square fluctuations from the data accumulated previously with the AddPos command. Depending on the Unit parameter, the RMS fluctuations are either returned in Angstrom or as B-factors. In the latter case, the B-factors are also transferred to the atoms .

The RMSF of atom i in Angstrom is obtained with the following formula, where j runs over the three cartesian components x, y and z of the atom position vector P, and k runs over the N coordinate sets added with the AddPos command:


(1)

The B-factor is obtained with the following conversion factor from the RMSF in [A]:


(2)

The complete procedure for obtaining RMSF values is as follows (and implemented as part of the macro md_analyze):

While per-atom fluctations are uniquely defined, fluctuations of larger units (residues, molecules) can be obtained in two ways:
  • Calculate the geometric center of each unit and calculate the fluctuation of its position. This operation is performed if the command extension of the AddPos command is not 'Atom'.
  • Calculate the per-atom fluctuations and then average the result over all atoms in the unit. This operation is performed if the command extension of the RMSF command is not 'Atom'.

All combinations are possible, e.g. you could add the fluctations of the geometric residue centers with 'AddPosRes' and then obtain the final result as an average over entire molecules with 'RMSFMol'.

Use the Clear command to clear the internal atom position table and start a new round of calculations.

Note that B-factors obtained with this command are typically larger than those found in X-ray structures. First the crystal environment reduces the protein's flexibility, and second crystal structures are usually solved at low temperature.

Example 1:
RMSFAtom Obj 1,Unit=A

Calculate the final root mean square fluctuations in units of Angstrom for the atoms in object 1.


Example 2:
RMSFRes Obj 1,Unit=A

As above, but average the result over the atoms in each residue.


Example 3:
RMSFRes Obj 1,Unit=BFactor

As above, but print the result as B-factors and set the atomic B-factors accordingly.


Example 4:
bflist() = RMSFAtom all,BFactor

Assign the root mean square fluctuations of all atoms to list 'bflist'.