Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

RMSD<Atom|Res|Mol|Obj>

-

Calculate RMSDs


CommandArgument DatatypeDefaultMinMax
Format:RMSD<Atom|Res|Mol|Obj> Selection 1, SELECTION ---
   Selection 2,SELECTION ---
   Match = Yes | No,STRINGNo - -
   Flip = Yes | No,STRING No --
  Unit = Unit for calculating RMSDs Obj | Mol | Res | AtomSTRING Obj --
Python:resultlist = RMSD<Atom|Res|Mol|Obj>(selection1,selection2,match=None,flip=None,unit=None)
Menu:Analyze > RMSD of
Related: Sup , Align
Required:


The RMSD command calculates the root-mean-square deviation between the cartesian atom coordinates in the two selections according to the formula below, where R is the vector linking the n corresponding atom pairs in space:


(1)

'Space' refers to the local coordinate system, not to the position on screen. So if you load the same protein twice, then move one protein away and calculate the RMSD between them, it will still be 0.000, because the local atom coordinates have not changed. Only the global position of one protein is different now. There are several ways of making sure that the calculated RMSD corresponds to what is visible on screen, described in the section about the local coordinate system .

You can find many additional hints about superpositions at the Sup command, including an explanation of the Match, Flip and Unit parameters.

Example 1:
RMSDObj 1,2

Calculate the all-atom RMSD between objects 1 and 2.


Example 2:
RMSDAtom Element !H Obj 1,Element !H Obj 3

Calculate the heavy-atom RMSD between objects 1 and 3.


Example 3:
RMSDAtom CA Obj 1,CA Obj 4,Match=Yes

Calculate the Calpha-RMSD between objects 1 and 4, ignoring those Calphas that are missing in object 1.


Example 4:
RMSDMol A,B,flip=Yes

Calculate the all-atom RMSD between molecules A and B, and flip equivalent atoms in molecule A to minimize the RMSD.


Example 5:
rmsd = RMSDObj 1,2

Assign the RMSD between objects 1 and 2 to variable 'rmsd'.


Example 6:
rmsdlist() = RMSDObj all,all

Assign the objects^2 RMSDs between all objects to 'rmsdlist'.


Example 7:
Tabulate RMSDAtom CA Obj 1-3,CA Obj 4-6

Tabulate the 9 Calpha RMSDs between objects 1,2,3 and 4,5, 6.