Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

QuantumMechanics

-

Set quantum mechanics method


CommandArgumentDatatypeDefault Min Max
Format: QuantumMechanics Method = MNDO | AM1 | PM3STRING ---
Python: QuantumMechanics(method)
Menu:Options > Quantum mechanics
Related: FormEnergy , Optimize
Required:


The QuantumMechanics command sets the semi-empircal method used to calculate formation energies and optimize geometries.

Calculations are performed by YAPAC, a specialized module derived from MOPAC, originally developed by James P. Stewart, with several extensions and bug fixes added during development.

The methods AM1 and PM3 are extensions to the original MNDO approach and generally more accurate.

  • The AM1 method should be used to optimize molecular geometries. Contrary to PM3, the difficult planar sp2 conformation of nitrogens is predicted well (e.g. the arginine side-chain is flat).

  • The PM3 method has been optimized to reproduce experimental formation energies and consequently performs best there. It should not be used to optimize molecular geometries, as the ability of nitrogens to adopt the planar sp2 conformation is underestimated, e.g. the arginine side-chain is not recognized as planar.

Example 1:
QuantumMechanics MNDO

Use the MNDO (Modified Neglect of Diatomic Overlap) method for quantum mechanics calculations.


Example 2:
QuantumMechanics AM1

Use the AM1 (Austin Model 1) method.


Example 3:
QuantumMechanics PM3

Use the PM3 (Parametric Model 3) method.