Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Quad-buffered stereo cannot be activated or flickers.

Apart from the trivial fact that YASARA Model+ is required for true stereo support, and flat LCD/TFT screens are too slow for stereo, a few additional things can go wrong:

If you click on Window > Stereo > Quad buffered and get an error message that this video mode is not supported, then your OpenGL driver does not allow to display stereo graphics this way.

Companies like nVIDIA and ATI usually provide the real stereo option only in their expensive workstation products (nVIDIA Quadro or ATI FireGL). YASARA does currently not support workarounds with reduced resolution like interlaced or sync-doubling stereo modes. The reason is that most of the time, you can enable quad-buffered stereo by fudging your video driver, e.g. to make a Geforce believe it is a Quadro, google for: nvidia enable geforce OpenGL stereo.

  • If you use Linux, stereo can be activated on Geforce cards with drivers 3XXX to 4496 or true Quadro cards with any driver version. No matter if you own a fudged Geforce or a real Quadro, it is still required to enable stereo by adding the Option "Stereo" to the file /etc/X11/xorg.conf, like in the example below:


Section "Device"
        Identifier  "Videocard0"
        Driver      "nvidia"
        VendorName  "Videocard vendor"
        BoardName   "nVidia GeForce 2 Go"
        VideoRam    32768
        Option      "Stereo"  "1"
EndSection

  • If you use Windows and have a Quadro-like card, follow these steps:

1. Right-click on the Windows-background -> Click the properties item

2. Display Properties opens -> Click on the Settings tab -> Click on the Advanced button

3. Click on the Quadro tab -> Click on the Additional Properties... button

4. Click on the OpenGL Settings tab

5. Scroll down the Performance and Compatibility Options list

6. Enable the Enable quadbuffered stereo API list item

7. Optional: Click on the Additional OpenGL Properties... if you want to change more stereo options

8. Close all setting dialogs

After that, stereo should work.

When switching the monitor off and on again, it might be that the shutter-glasses will be out of sync. To fix this, just click on Window > Stereo > Swap

If stereo works but the image flickers , this indicates that the screen update frequency is not set high enough. As an application, YASARA can unfortunately not influence the screen update frequency all by itself, you have to do that manually:

  • If you use Linux, edit the file /etc/X11/xorg.conf. Make sure that the VertRefresh setting in the "Monitor" Section is high enough, which is however only accepted by the X-server if the HorizSync setting is also high enough. Setting HorizSync higher than your screen supports can destroy the screen, check the maximally supported KHz in the screen manual.

  • If you use Windows, follow this protocol:

1. Click Start, click Control Panel, click Appearance and Themes, and then click Display.

2. Click the Settings tab, and then click Advanced.

3. Click the Monitor tab, and then click the screen refresh rate that you want to use, at least 100 Hz for stereo.