Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Preparing the topology

Before a simulation can be run, appropriate force field parameters have to be assigned to all the residues in the soup . While this is straightforward for well known ones like the standard 20 amino-acids or common ions, it is far from trivial for the infinitely many other molecules that nobody has explicitly parameterized yet.

Especially PDB files often contain ligands and cofactors at rather low resolution and without hydrogen atoms, and it is very challenging for a computer program to automatically analyze the molecule, assign the right bond orders and subsequently add the missing hydrogen atoms. Further complications arise from the fact that bond orders and protonation states depend on the pH you want to simulate.

A lot of efforts have been spent to make YASARA smart enough to do all this automatically, and in the majority of cases it is enough to follow these simple steps:

  • Click 'Options > Default pH' to set the pH you want to use during your simulation.
  • Click 'File > Load > PDB file' to load your protein and assign bond orders according to the chosen pH.
  • Click 'Edit > Clean > All' to add the missing hydrogen atoms and correct any problems.
  • Look at non-standard residues (e.g. press <F2>, then <F6>) while showing the bond orders to verify that YASARA has made the expected choices.

The problem of assigning bond orders and adding missing hydrogen atoms is an ambiguous one, in many cases multiple correct solutions exist. If YASARA does not make the intended assignments, there are several options:

  • Provide a hint for the favored solution by explicitly adding hydrogen atoms or setting bond orders to critical atoms.
  • Extend YASARA's chemical knowledge using the simple SMILES-based assignment of pH-dependent bond orders and protonation states in the GROUP_DATA section of the file yasara.def (present in YASARA Dynamics+). How that works is explained in detail there, and please forward your modifications to us, so that they can be included in the next update.
  • Add a complete topology entry for your residue to the TOPOLOGY_DATA section in the file yasara.def. This option is used for all the standard residues but should be avoided for the others, because it introduces a dependency on residue and atom names - and these are essentially random choices left to the crystallographers for all but the standard residues.