Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Prop<Atom|Res|Mol|Obj|All>

-

Set/get the property value


CommandArgument DatatypeDefaultMinMax
Format:Prop<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   value = Property value to set FLOAT---
Python: Prop<Atom|Res|Mol|Obj|All>(selection1,value)
resultlist = Prop<Atom|Res|Mol|Obj|All>(selection1)
Menu: Edit > Renumber > Property value
Related:BFactor , Occup, Color , ColorPar
Required:


The Prop command sets or gets the property values of the selected atoms. The property value is simply a floating point number associated with an atom, like the B-factor or the occupancy. It is not part of the PDB format and can therefore not be saved with SavePDB. Only the YASARA specific commands SaveSce and SaveYOb preserve the property value.

When coloring by property value, a value of 0.0 corresponds to yellow, and a value of 1.0 to blue by default. Other color schemes can be defined with the ColorPar command. A property value of -999 indicates that no property could be assigned to an atom, which always maps to the color gray.

The atomic property value becomes especially useful in the Twinset, where it corresponds to WHAT IF's atomic value displayed in the rightmost column of the LISTAA output. This value is set by many WHAT IF commands and made easily accessible in YASARA by the Prop command.

YASARA also supports selections by property value .

Example 1:
PropAtom 124

Get the property value of atom 124.


Example 2:
PropAtom Mol A

Get the property values of the atoms in molecule A.


Example 3:
PropMol A

Get the average property value of molecule A.


Example 4:
PropRes His Arg

Get the average property values of all residues named His or Arg.


Example 5:
property = PropObj 4

Assign the average property value of object 4 to variable 'property'.


Example 6:
propertylist() = PropRes Obj 3

Assign the average property values of the residues in object 3 to the list 'propertylist'.


Example 7:
PropAtom Backbone,-500

Propertize all backbone atoms with the value -500.