Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Projection

-

Set perspective or parallel projection


CommandArgumentDatatypeDefault Min Max
Format: Projection Type = perspective | parallelSTRING ---
Python: Projection(Type)
Menu:View > Projection
Related: AtomSize
Required:


The Projection command switches between two different projections:

  • Perspective projection: Creates a realistic view, where atoms get smaller with increasing distance from the viewplane.

  • Parallel projection: Assigns the same size to all atoms on screen, independent of their distance from the viewplane. Using this projection for a long time can cause headaches, but may be helpful in certain situations. This projection uses the distance of the scene's geometric center (returned by the PosAll command) from the viewplane to scale the atoms. Hence all atoms change their size together while the scene is moved along the Z-axis. If the geometric center of the scene falls behind the viewplane, the atoms keep their maximum size and no further scaling is done to indicate the movement. Even if only one object is moved, this also affects the center of the scene and thus the scaling.

Any changes in perspective require a re-initialization of YASARA's graphics engine, continuous adjustments are thus not possible.

Example 1:
Projection perspective

Switch to perspective projection, atoms get smaller in the background.


Example 2:
Projection parallel

Switch to parallel projection, all atoms have the same size.