Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Processors

-

Set/get number of processors to use


CommandArgumentDatatypeDefault Min Max
Format: Processors Number = Number of processors to useINT-1 16
Python:Processors(number)
resultlist = Processors()
Menu: Options > Processors
Related:Sim
Required:


The Processors command tells YASARA how many processors to use in those parts of the program that support parallel execution. Currently these are:

  • Molecular simulations with all force fields except NOVA.
  • Molecular graphics and shadows.
  • Calculation of numeric molecular surfaces and volumes.

Optimal performance is achieved if the Processors setting matches the number of logical processors in your computer (e.g. for a Pentium D Extreme Edition, with two CPU cores and hyperthreading enabled, you would set Processors to 4).

Here are a few additional hints:

  • YASARA does not complain if you set Processors too high (e.g. 6 on a simple 1 CPU machine), but performance will be lower due to the task-switching overhead. Since a simulation is influenced by the number of processors used, this feature allows you to reproduce a simulation run on multiple CPUs also on a single CPU (assuming it's a similar CPU and operating system).

  • If you want to run two instances of YASARA in parallel on the same machine, select only half of the available processors for optimal performance.

  • When longrange interactions are activated, YASARA currently reaches a performance limit at 3 to 4 CPUs. Providing 5 or more CPUs will thus not speed up simulations any further.

  • The parallel MD performance is reduced on old Linux kernels like 2.4.X and before, since these contain an unsolvable problem in the process scheduler. Use kernel 2.6.X or higher.

  • If you choose two or more processors, YASARA needs to do its own scheduling for optimal performance and cache usage. As a consequence, the main YASARA process is bound to a certain CPU.

  • When running a simulation on more than one processor, the Linux 'top' command usually shows a CPU usage close to 100*N%. In some Linux distributions, there seems to be a bug in 'top' that makes it always show less than 100%. Neverthess, YASARA correctly uses the selected number of CPUs.

Example 1:
Processors 1

Use only one processor.


Example 2:
Processors 4

Use four processors in parallel.


Example 3:
Processors all

Use all available processors.


Example 4:
used,available = Processors

Assign the numbers of used and available processors to variables 'used' and 'available'.