Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Print

-

Print text


CommandArgument DatatypeDefaultMinMax
Format:PrintText = Text to printSTRING - --
Python:Print(text)
Menu: Effects > Text > Print
Related:Font , PosText, MakeTextObj , PrintObj, PrintCon , PrintHUD
Required:


The Print command outputs the specified text to the current printing target. This is the console by default. Alternatively, the output can be redirected to a text board for printing 3D letters or to the head-up display.

As with all strings, you can use optional double (") or single (') quotes as string delimiters.

Example 1:
Print Hello World!

Print the text 'Hello World!' to the current print target (console,object or image).


Example 2:
Print " Hello, World! "

Print the text ' Hello, World! ' to the current print target.


Example 3:
Print This text\nhas two lines

Print two lines of text, 'This text' and 'has two lines'.



Example macro:

# EXAMPLE Print
# Requires YASARA Model
Clear
MakeTextObj YASARA,Width=150,Height=20
PosText 50%,0%,justify=center
Font Baikal,Height=100%,Color=Yellow,Depth=50,DepthCol=Red
Print "YASARA"
PosObj YASARA,0,-30,50
OriObj YASARA,70,-63,-4
LoadPDB 1crn
Style Ribbon,Stick
PosObj 1crn,0,3,33
OriObj 1crn,42,-48,-12
AutoRotateAll Y=1

Figure: Result of the example macro above.